Virtual Metagenome

A web server to reconstruct metagenomes from 16S rRNA sequences.

Introduction

Microbial ecologists have investigated roles of species richness and diversity in a wide variety of ecosystems. Recently, metagenomics have been developed to measure functions in ecosystems, but this approach is cost-intensive.

We developed a novel method for the rapid and efficient reconstruction of a virtual metagenome in environmental microbial communities without using large-scale genomic sequencing [Okuda, S. et al. Nat. Commun. 3:1203 2013]. Our method is useful for 16S rRNA gene sequence data obtained from gel-based method like denaturing gradient gel electrophoresis (DGGE) analysis or large scale sequencing technologies, mapped to fully sequenced genomes, to reconstruct virtual metagenome-like organizations.

» See calculation result sample

Statistics

Number of genomes2706
Number of KOs7522

Start calculation

This tool is for virtual metagenome predictions from your 16S rRNA sequences.
If you have the set of 16S rRNA sequences you have identified, you can predict metagenome-like organizations. See help page for more detail.

Parameters

Calculation mode:

help

There are three different calculation modes for module prediction.

  • All
    This mode reconstructs a metagenome based on genes conserved across the closely related genomes including sibling genomes to the query 16S rRNA sequence. This is the default option.
  • Nearer
    This mode reconstructs a metagenome based on genes conserved across the very closely related genomes to the query 16S rRNA sequence.
  • Nearest
    This mode reconstructs a metagenome based on genes contained in the nearest genomes to the query 16S rRNA sequence.

Conservation rate:

help

You can specify the threshold to extract conserved genes across the closely related genomes. If you don't give this option, the server will use 0.1 as the threshold. This means that genes conserved in less than 10 % of the closely related genomes are neglected.

Existing probability:

help

Finally, the server provide the list of ortholog genes as KEGG Orthology identifiers with the existing probabilities in the reconstructed virtual metagenome. If you specify the threshold of this option, you can select the genes exist with higher probability than the threshold.

Squences

*Over 1000 sequences are NOT allowed.

FASTA file:

or paste below

help

Input data should be described as a multi-fasta format like below. Example:
> SEQ1_ID VALUE
ATGCTATTGGCAGA.......
> SEQ2_ID VALUE
GTGTGCCAACATGA......
VALUE is a relative abundance of the sequence. If you don't provide it, the server addresses all sequences equally.
*Over 1000 sequences are NOT allowed.

Example:
> SEQ1_ID VALUE
ATGCTATTGGCAGA.......
> SEQ2_ID VALUE
GTGTGCCAACATGA......
VALUE is a relative abundance of the sequence.
If you don't provide it, the server addresses all sequences equally.
» Show Sample sequence

>seq1 0.4
TGCAGTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGTGTGAT
GAAGGCTTTCGGGTCGTAAAGCACTGTTGTATGGGAAGAACAGCTAGAATAGGGAATGAT
TTTAGTTTGACGGTACCATACCAGAAAGGGACGGCTAAATACGTGCCAGCAGCCGCGGTA
ATACGTATGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTGA
TTAAGTCTGATGTGAAAGCCCGGAGCTCAACTCCGGAATGGCATTGGAAACTGGTTAACT
TGAGTGCAGTAGAGGTAAGTGGAACTCCATGTGTAGCGGTGGAAT
>seq2 0.2
TGCAGTAGGGAATCTTCCACAATGGGCGCAAGCCTGATGGAGCAACGCCGCGTGTGTGAT
GAAGGCTTTCGGGTCGTAAAGCACTGTTGTATGGGAAGAACGGTAAGGGTAGGAAATGAT
CTTTACATGACGGTACCATACCAGAAAGGGACGGCTAAATACGTGCCAGCAGCCGCGGTA
ATACGTATGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTTG
ATAAGTCTGAAGTGAAAGCCCACAGCTCAACTGTGGAAGTGCTTTGGAAACTGTCAAACT
TGAGTGCAGTAGAGGTAAGTGGAACTCCATGTGTAGCGGTGGAAT
>seq3 0.8
CCTACGGGAGGCTGCAGTAGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGC
CGCGTGTGTGATGAAGGCTTTCGGGTCGTAAAGCACTGTTGTATGGGAAGAACAGCTAGA
ATAGGGAATGATTTTAGTTTGACGGTACCATACCAGAAAGGGACGGCTAAATACGTGCCA
GCAGCCGCGGTAAT
>seq4 0.1
CAGGCGGTTTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGAAGTGCATCGGAA
ACTGGGAGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATGTGTAGCGGTGGAATGCGT
AGATATATGGAAGAACACCAGTGGCGAAGGCGGCTGTCTAGTCTGTAACTGACGCTGAGG
CTCGAAAGCATGGGTAGCGAACAGGATTAGATACCCTGGTAGTCCATGCCGTAAACGATG
AGTGCTAAGTGTTGGAGGGTTTCCGCCCTTCAGTGCTGCAGCTAACGCATTAAGCACTCC
GCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGC
GGTGGAGCATGTGGTTTAATTCGAAGCTACGCGAAGAACCTTACCAGGTCTTGACATCTT

Use this sample
Close